Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13192A2
Clone ID IST13192A2
Vector VICTR74
Project tigm

Sequence tag IST13192A2BBF1
Sequence
GTATTTGCTATCCATTCCTCCAATTTTTTGCGATATTGGAACCAAATGTTAGTGTATTTAACATACGTTTTCTTTGTATA
AAAGTTAGCTTAAAAGACCATAGAGTGGATGTAAGCAAGCATACAGCACGCTATTCTGGTGAGTGAAATGCCTCTTTTCC
TGCCAATATTTTTAGTATCTTTTTTAAAGATCATTACCATTTTGTTTTAGGGGAAAATATTACCTAAAAATTTTTGCTTT
GTGTGTNTNTGTGGGGGGCTTTTTTGTTTCCTTTTGANACNGGGTGTCAGTGCANCTCANGCTGGCCTCAAATTAACTAT
GTGGTCAAGGATGACCTTGAACTTGTANATCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62350849..62351200 338
 
EST/CDNA Est Name
  BP753711.1 - CA463510.1 - AI647021.1 - AI462133.1 - AI607840.1 - BG094429.1 - CF983349.1 - BE623045.1 - BE623050.1 - BU583653.1 - AI835789.1 - AI838470.1 - AI841471.1 - BU938615.1 - AA958960.1 - AW048958.1 - AI838029.1 - Z31141.1 - CA466647.1 - AA217149.1


Sequence tag IST13192A2HMR1
Sequence
GGTGCAGGCTCTAGACAGCCTTGTTTCATCCCAGGGAGAGACCTCTGATCTCTCTTGGGGTTGGCAAGCTCGTTCAGTTG
AGGCAAGTATCCCTTACTCTTATGTAAGGCATATTTTATATAAAGCGTCTTCTGACCCTCCTACCCTTAAAAACTTGAAT
TATTGATTGCGTGTGCTGCCACCCTGTGAGTGAGCATTCANAGGACGGGAGGGCTGATCTATCTGGGGTCATTCATTCNT
TANCTGT
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168588766..168589012 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es