Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12453D2
Clone ID IST12453D2
Vector VICTR76
Project tigm

Sequence tag IST12453D2HMF1
Sequence
ATATAATGCCCAGTATAGGGAGAACCCTTAAGATCAGGATCTGTTGGTGATTAAATGGCTTTATTTACAGTTGTACATTA
CCGAGCTGCTAATCTTAAGGCTATAACACGAAATTTGCTTGCTAGGTCATCCCTTTTCATGGCTCACTTGTTTTTCTTTC
CTTTTCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14545

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77334072..77334248 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]


Sequence tag IST12453D2BBF1
Sequence
ATATAATGCCCAGTATAGGGAGAACCCTTAANATCAGGATCTGTTGGTGATTAAATGGCTTTATTTACAGTTGTACATTA
CCGANCTGCTAATCTTAAGGCTATAACACGAAATTTGCTTGCTAGGTCATCCCTTTTCATGGCTCACTTGTTTTTCTTTC
CTTTTCNTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14545

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77334072..77334248 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]

 
Come back to gene ENSMUSG00000055923


For any suggestions or comments, please send an email to unitrap@crg.es