Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0476
Clone ID AK0476
Vector pGT0lxr
Project sanger

Sequence tag AK0476
Sequence
CTTTCATCCCTCTCCCCAGGCCTTCCCCTTTTAAATCTCCGTTGGCAGGCAGTAGGGGCTCTGCACATGGCTGCTCTAGG
CATCTTCAAAAGAGAAACTCCCCCTCTCAGGAGGAGCTCCTCCAGCCTGCTGGATCAGAGGCGTCATATGAGCCACACAA
TTCAACAGGGCAGTCTTGCCTGCCAAGGCGAGAGCTAGAAGGAACCCCATACCTGGGATCTGGAATCAGCCTTTTCTCTA
GTAGAGACCCCGAATCTGAGTCCCCTAAAGAGCCAGCCCACATTGGCACCACACCAGCTTCAACCTCTGCACTGAAAATA
CCCCAAGGTCAAGTTGCTTTCCGGAGTGCAGCTGCTGCTGGTGCTGATAAAGCAGTGGTAGGAATTGTGAGCAAGATAAA
GCCGGAATTGACATCTTCAGAAGAAAGAGCGGATAGAGACATATCCATGGTGGTGTCAGGCTTGACCCCCAAAGAAGTA
Sequence Type mRNA
Unitrap ID UNI3247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101369264..101371432 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es