Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0417
Clone ID AK0417
Vector pGT0lxr
Project sanger

Sequence tag AK0417
Sequence
ATAAAATCCCTTTAGCATCCGTGTTGGGACCGGGAAGCCAGAGCCCTCTCTCTACCGTGCTGTGTATGTTCTCCTTCCTA
GTCCCTATGTGAGGGGATGCGGATTTTGGGCTGTGTGATTGGTTGGGAGCTGTTGTAGATGGTGGTCAGCCTTCCCAACG
GCCTCCAAGGGTTTGTGCAAGTGACCGAAGTCTGTGACGCCTACACTCAGAAGCTGAATGAGCAGGTGGCACAAGAAGAA
CCTCTGGAGGACCTGCTCCGCCTGCCTGAGCTCTTCTCCCCTGGAATGTTGGTGAGGTGTGTGGTGAGCAGCCTGGATGT
CACAGAGAGCGGCAAGAAGAGCGTCAAGCTTTCTGTGAACCCCAAACGTGTCAACAAAGTGCTGAGTGCTGAGGCCCTGA
AGCCTGGCATG
Sequence Type mRNA
Unitrap ID UNI3249

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47169617..47171506 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es