Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14188C7
Clone ID IST14188C7
Vector VICTR74
Project tigm

Sequence tag IST14188C7HMF1
Sequence
CAACCACTGCGTGTGAGCATGCAGGTGTGTACGACATATGGCAGGGTGTGAGCCCCCATGGCACATGTGCGGAGATCAGA
GGACAACTTTCAGGAGTCGGCCCTCTCCATCCAGATGGAACTCTGGTTGTAAGACATGCTTGGAAGGCATCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66499568..66499725 158
NO GENE  


Sequence tag IST14188C7HMR1
Sequence
GTTGGGGCTTATTCTGTGTTTTTCAATAGTGAGAGTCCATGCCCTCCATTAAGGTGCACTGAGGCAGAGAATCTTTGCTG
ACTGTGCGCTTATTGCTCCTCACTGATCCTGGCCGTCTGCCTTACCACAAGAACTCAGACTTGGGGCTCTTTGTATCCTG
GTGCCCCGTGGTTCTCTCACCCTGTGTGACTTANCTCTCAGTGTGGCAGCAGGCANCCCTGTGAAGCACAGTAGGTTANA
ACAGCANACGCCGATGTCTTCCTAAGCGTCCCCAAGGCANGTATTTGATTGCANCANTGTTGGCCC
Sequence Type genomic DNA
Unitrap ID UNI24544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66499267..66499571 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es