Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11504E3
Clone ID IST11504E3
Vector VICTR76
Project tigm

Sequence tag IST11504E3HMR1
Sequence
TGAGCAGCCTACCTCTAGGTTNAGTGTCACAAAGTGGANAAGGCTTAAAGAAGATCCAACCTCTTCTTCATGCACACATG
TGCACATGCGTATACACATGCATGCATGCACAGACACACACACATACATACACACACACACATACATACACATACATACA
CACATACACATACAAACATACACATACATACACACATACACATACATACACACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI35896

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108314637..108314861 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040412 (5330417C22Rik) NM_001033304 RIKEN cDNA 5330417C22 gene Gene [Source:MGI Symbol;Acc:MGI:1923930]

 
Come back to gene ENSMUSG00000040412


For any suggestions or comments, please send an email to unitrap@crg.es