Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11262H11
Clone ID IST11262H11
Vector VICTR76
Project tigm

Sequence tag IST11262H11HMF1
Sequence
CTTTAAACTAATTTCAAGTGCATGGAAACTATACTGAGAAGACTGCTGGGATCCATGGCAATTCTGTCATTTTTATGAGA
AGTCAGTANAATTGGATTGCTTGGGAGTAGGTATTATGTGCAAATGTATCANAATACATACATTAACTATGTAAAATTTT
ATATCNNCTATNACACANNATGGTCTNAACTNATTTTTATTGACATCTATGAAAAATCCCAACCTACTGCTTTCNNANTT
NATTNNTAATACACNNNCCTGTNTCATATTCATANTCANTANTNNATTCTGGNCNATGCCTTATTTTCACTCTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11262H11HMR1
Sequence
AAGAAGAACCAGANNTNTNATGTTCATTGCAGTTGTATTATGGTAGCCTAAATAAAAGAATTACCTCAGTGCTCATTTGT
TGAGGAAAAGCTGGGTGCCTTAAGGTGACATTGTGCTAAAGGAATGAAGACAATAGTAAAGGTTAAATGATTAAGTTCTT
GTAAAGACTCTCAGAGTCAGTGCTGTATTGGTCATAAAAACGGCATATAATTACAGCTTAAGCCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 97450305..98298669 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]


Sequence tag IST11262H11BBF1
Sequence
CTTTAAACTAATTTCAAGTGCATGGAAACTATACTGANAAGACTGCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121812602..121812654 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298667..98298719 51
NO GENE  

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es