Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10454E11
Clone ID IST10454E11
Vector VICTR76
Project tigm

Sequence tag IST10454E11HMR1
Sequence
NTGGAAAATCATTCAGTGAGATGTTACCAATCGCGGCTTTCCTGGATCACCTCTGTTTAAGCAGGGATTTCCTCCTGGAG
TTCTGTCCCACTGTCTCCTTTTACTTTCTAAATAATCAGACTTACTTCCTGGGCTTGTCATTTGGGTATGTGCTAATGGA
TCTGGTGCCTGTTCCACTCCAATGGTACTTAAATTGGATGTGGCATATCTTGTCTCTCTTCTCCCCAAGGTGGAGGACAG
CTAANANACNNNTAATCAAAACACNTGATTACNGATGGC
Sequence Type genomic DNA
Unitrap ID UNI32085

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131061901..131062177 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037523 (D430028G21Rik) NM_144888 RIKEN cDNA D430028G21 gene Gene [Source:MGI Symbol;Acc:MGI:2444773]

 
Come back to gene ENSMUSG00000037523


For any suggestions or comments, please send an email to unitrap@crg.es