Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11386G2
Clone ID IST11386G2
Vector VICTR76
Project tigm

Sequence tag IST11386G2HMR1
Sequence
TATAATCCTACTCTTGGATGGTGCTAAAAGGACTTTGGAGGGTAGGGGTTGGAAGGGGAAGTTAATAGTTCATGTTACTG
CTGAAGGCCACCCACCTATCCACTCCTCCCCACACTTTCCGCCTGGTAAATACAGGATTTCCTGCCTCANGCNNNAATCT
GCTGTAANAGCCTGGATTCTATGGGGAGGGCTNTCCCNCCCTCCTGGTGGCTGANTTGGGGANGGGTCATN
Sequence Type genomic DNA
Unitrap ID UNI21606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101325687..101325916 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034993 (Vat1) NM_012037 vesicle amine transport protein 1 homolog (T californica) Gene [Source:MGI (curated);Acc:Vat1-001]

 
Come back to gene ENSMUSG00000034993


For any suggestions or comments, please send an email to unitrap@crg.es