Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14640H3
Clone ID IST14640H3
Vector VICTR74
Project tigm

Sequence tag IST14640H3HMF1
Sequence
TATCCTCTCCACTGAGAGAAGGCCCACAAACATCTTCTAGCCCCCTGAGGTTCCGACCAACATCGTGAAGACAGGGAAGT
TAGGATGGGAACACTCACCGGGTGAGGAGTCACGTCAATATGGTTTATTCCTAGGCTATTAGCCAAGTCTAGTATCCCTG
TCACAGAGATGCTGGAAGTACAGAAAAGACTGGCTACTACAGGCAGCCTGTACAAGCTGCAGATTCCACCTGTTCCAAAG
GGAAGTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 76496673..76496922 250
NO GENE  


Sequence tag IST14640H3HMR1
Sequence
GATAGACTAAATCCTTAGACTTGCTTGCCTGACTGTTAAGAAGTAGCCTCCTCCCAGTGAGACTCAAGGACTCCGGGAGC
TGCTCAGATGGACTCAGCAGGGCACAGAGCCTCTGACTTTGCAGAGCCTGACACATTCTCCGGGCTAGGGAGCCGGATGT
GTGCCTTCCAACAAGGCACTGGGGCTGAGGAAAGAGATTGATTCTGGGCATTTGAGCCAGTGGCAAAGATACNNTCC
Sequence Type genomic DNA
Unitrap ID UNI17465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 76496919..76497150 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001436 (Slc19a1) NM_031196 solute carrier family 19 (sodium/hydrogen exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:103182]

 
Come back to gene ENSMUSG00000001436


For any suggestions or comments, please send an email to unitrap@crg.es