Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14852C3
Clone ID IST14852C3
Vector VICTR76
Project tigm

Sequence tag IST14852C3BBF1
Sequence
GTTTCTCCCCCTGCACGTTTCTCTACCCTGTGTCTGAGCCATTGGCTCCCACCACTTACATCAGGAAAGTAAATATCTGC
CTTCATCTGGCTGGAAGCTGTGCTGGAGCAGCTCTGACTATCGATGGAAACCATTCCCTTTGGCTCCTAATTCCAACTCC
AACCTCTGCACACACGTGTTCTCCCCTGCCGTCATCTACACAAACGTACATTTCTAAACCAGTTATTCGGTCTGGAGAGT
CCCATGGTTAGACTTTGTCTCTATTTTGGTAGGAATATAAAACAAACTGATTTTCTTTTAAGAAAGTAGAAAGTATAAAA
TTAGGGATATTGCTGGGCGGTGGTANCACATGCCTTTAATCCCAGTNCTCTGTGAGTTCNAGGCCNNCCTGGTCTANNGA
ATGANTTCTACAGGACAGACAGGNCTAGACNNAANAATCTTGTN
Sequence Type genomic DNA
Unitrap ID UNI22706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15108738..15109180 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]


Sequence tag IST14852C3HMF1
Sequence
GTTTCTCCCCCTGCACGTTTCTCTACCCTGTGTCTGAGCCATTGGCTCCCACCACTTACATCAGGAAAGTAAATATCTGC
CTTCATCTGGCTGGAAGCTGTGCTGGAGCAGCTCTGACTATCGATGGAAACCATTCCCTTTGGCTCCTAATTCCAACTCC
AACCTCTGCACACACGTGTTCTCCCCTGCCGTCATCTACACAAACGTACATTTCTAAACCAGTTATTCGGTCTGGAGAGT
CCCATGGTTAGACTTTGTCTCTATTTTGGTAGGAATATAAAACAAACTGATTTTCTTTTAAGAAAGTAGAAAGTATAAAA
TTAGGGATATTGCTGGGCGGTGGTAGCACATGCCTTTAATCCCAGTACTCTGTGAGTTCNAGGCNNGCCTGGTCTACAGA
ATGAGTTCTACAGGACAGACAGGACTAGACAGAAAANNNNNGTCTCCN
Sequence Type genomic DNA
Unitrap ID UNI22706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15108734..15109180 431
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]

 
Come back to gene ENSMUSG00000031938


For any suggestions or comments, please send an email to unitrap@crg.es