Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10009G2
Clone ID IST10009G2
Vector VICTR75
Project tigm

Sequence tag IST10009G2BBR1
Sequence
AGCTCCCCTCCTTTTAAAGAGATGAGGCTGAAAGAATGTGGAGCCTGCCAGGACAGCTAGGCTGCTCCCAGCTCCTGCAG
CTCCCAGGCGGCTGCCAGGTTCCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI16343

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75110244..75110353 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]


Sequence tag IST10009G2HMF1
Sequence
AGCTTATCCAGGGCCTGCCTGGTCTTTGTGAGCTGGCGCCATGTCCTTCCCTCTTGAGTGGTCTGTGGGAGACCTGGCCA
G
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75110350..75110429 80
NO GENE  

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es