Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14169D11
Clone ID IST14169D11
Vector VICTR74
Project tigm

Sequence tag IST14169D11HMF1
Sequence
NANNNGGNNNANGACNANNGANGTGGGANTACCNNANGGACCTGGAATATGANAGTCNNTCANNACNTTTNANAAACANA
NANAANCCNNGGGTGTTGGTGCTTGCNTGCAATGTGAGTGCNTNGGAANCTGAANCTAAAGAATCCTCTGGACNANCCTG
NNCTAGGANCANTGAGGTCTGGGCNACCCTNNCTACANANACCATTTCAAAAAGAAAACAATGACAAANGGAGGCTGTTC
CAGGAANAATAGACAGCANGGTGTGGAAAGGCCTAANACTGGANCNAGCCTTCTGTGCTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14169D11HMR1
Sequence
GACCCCCACCANCTTGTGACACTTGGATTTACCCGTTTATCCTCTGGTTTCAAGTTCTGACCTGTGTCTCCTGTATCATG
ATTATGGCTTGATATTGGACATGTTTGTTGAGTGACTTTGTGATTGCAGTTTACAGCAATATAATCATAGCTAGTTCTTG
TTGCTTGCCTATTGTGGGCAGAGCTGTAACCCTCACACTTGTACGTATTACTTCATTTAACGTTATGATTTGTGTGAAGC
TGAAACAGTTTCCACTTCTCANATACANAAACTGAGGCCCTGAGAGGTTGAGTCACTTAATAATCACTTANCTGGCAGGT
TCAGGAANATATGANCTGTCCCNGACNGGGGCTGGGGGAAGGGAGGACAGGCANGNNGCTGTTTANGAGGGGAAGTTCTT
TCG
Sequence Type genomic DNA
Unitrap ID UNI13542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8666761..8667162 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es