Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0251
Clone ID AK0251
Vector pGT0lxr
Project sanger

Sequence tag AK0251
Sequence
CCTTCCTACAGCCTTACCCACCATTTATGCCTCGGAGACTCACAGGACGTAGTAGATACCGATCCCAGCAGCCAATGCCC
CCTCCTCCTTACCATCCCAGCTTACTACCATACGTGCTATCAATGCTTCCAGTACCACCTGCAGTGGGCCCAACCTTCAG
CTTTGAATTAGATGTAGAAGACGGAGAAGTTGAAAATTATGAGGCCCTGTTAAACTTGGCGGAGAGACTGTTAGAGTTGG
GGTTTTTGGGGATTTTTTAAAGTGGGTTTTGAACATTTTCAATAGTTTGGGTTGGGGGTTTTTTAAAGGGGTTTTTTTTT
TTTCCAGGTGTGTAGTATGCATGTGTGATTTTGAGTCAAGGCAGCTTCTTAGAGTCTTACCTTGTAACCACGAGTTCCAT
GCCAAGTGTGTTGATAAATGGCTTAAG
Sequence Type mRNA
Unitrap ID UNI3257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44144416..44150544 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035696 (Rnf38) NM_001038993 ring finger protein 38 Gene [Source:MGI (curated);Acc:Rnf38-017]

 
Come back to gene ENSMUSG00000035696


For any suggestions or comments, please send an email to unitrap@crg.es