Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15086E3
Clone ID IST15086E3
Vector VICTR80
Project tigm

Sequence tag IST15086E3HMF1
Sequence
AGATCACTGACTGCAATCAATCAAAAAACGCATCTGGGTACGTCTGAGCAGACTCCTGCCCTCAGCAGCCTTCGAGGTAG
AGTGAATGAGTCTTTTTCTTATAATTATATTAGTTGGCAGACATGTACAATGAAAGTTACAAACCCCTGATGTAGATGGA
AGAGCATTTTTGTTGCTCATTTGAAGCTGGGTTGGAAGAAAAATCATTTAATCTATTTAAACTTGAACTTTGTAACAGTG
CAGTCTTCCATTTCCCAGGAAACAAAGGTATGTTAGTAGAAACGGCCTTGCGGTGAACAGCTTCTTANAAAAGACAATTG
TTAACG
Sequence Type genomic DNA
Unitrap ID UNI25563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42308247..42308571 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]


Sequence tag IST15086E3HMR1
Sequence
NCTATAGATTACACTGAGGACTGACTGCAACCTGAACCNCACTTCTGTCTGAAAATATGTTCCTTGAATACATTGAAAAT
GGCTCTACTGATCAAGTAANAATTTTCTATTTTATTCCATTGTTTCCAATGGACACCCAGAAGTANCTATTTCCACAAAA
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42308570..42308729 154
 
EST/CDNA Est Name
  BU562066.1 - BY256628.1

 
Come back to gene BU562066.1 - BY256628.1


For any suggestions or comments, please send an email to unitrap@crg.es