Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13666F6
Clone ID IST13666F6
Vector VICTR74
Project tigm

Sequence tag IST13666F6HMR1
Sequence
AAGTTAAAAGAGCGCTGGGCTTGTAAAAATTTCATATC
Sequence Type genomic DNA
Unitrap ID UNI13682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169212800..169212836 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026558 (AC142244.11) NM_030724 Uridine-cytidine kinase 2 (UCK 2)(EC 2.7.1.48)(Uridine monophosphokinase 2)(Cytidine monophosphokinase 2) [Source:UniProtKB/Swiss-Prot;Acc:Q99PM9]

 
Come back to gene ENSMUSG00000026558


For any suggestions or comments, please send an email to unitrap@crg.es