Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15100A8
Clone ID IST15100A8
Vector VICTR80
Project tigm

Sequence tag IST15100A8HMF1
Sequence
CAATAGAACTAGAAGAATCATATATCTGAAAATCTTTCGTTCCTTTCTTTCTTCCTTCCTTCCTTTCTTTCTTTCTTTCT
TTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 92387331..92492771 73
NO GENE  


Sequence tag IST15100A8HMR1
Sequence
AAGANAGTTTCTTCCTGCCTGCCTTCTCATGAAGATGCAGAATTCTCAGCTCCTTCTTTAGCATCATGGCTGCCTTCATG
CTGCCATGCTTCCTGCTATAATGGTAATAAACTAAATATTTGAAACTGTAAGCCAGGCCCAAATAAATATTTACCTTTAA
AACAGTTGCCTTGGTGACAGTTTGTCTTCTGAGCAATGGAAATTCTTTCTAAGACAGAAGTTAGTACCCCAGACTTAAGT
ATTGCTATGATAGGCC
Sequence Type genomic DNA
Unitrap ID UNI7038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66496999..66497254 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074834 (Vmn2r-ps105) vomeronasal 2, receptor, pseudogene 105 Pseudogene [Source:MGI Symbol;Acc:MGI:3040709]

 
Come back to gene ENSMUSG00000074834


For any suggestions or comments, please send an email to unitrap@crg.es