Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10436H7
Clone ID IST10436H7
Vector VICTR76
Project tigm

Sequence tag IST10436H7BBF1
Sequence
GAGTTAGGGTTAGGCCATTGGGAATGGGTGTTGAGGACTGGACTTAAGTCCTCTATAAGAAGAGTATGCACTCTTTAACT
GTTGAGATGTCTTTCCAACATCAAAATAAAATATAGAAGGAAGAGGAGGAGTACAGATGTAAGGAGGACTTACATACGTA
CTCACACACTGAATTCTGAGGGCCCAAGACTACACTGGCTTGTGAGTTATGTGTACAAGTGAAAGTAGCCAAAATTANAA
TANCTTTACNAANTCACTTGATTTTTGTGGGGTTTTGTTTATTCATTTGTTTTGTCTTCTTAATTGTCTTTATTTTATTC
TTTTNACTTTTTTTTCTTCTATTTGAAAGTAGATTCTCTTCTCGTGCAGTATCTTGATGTTGGTTTCCTCTCCCTCTCTT
CCTCCCCGTTCCTCCCTACTTTGCCTCCTGTCCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67601556..67601993 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019947 (Arid5b) NM_023598 AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

 
Come back to gene ENSMUSG00000019947


For any suggestions or comments, please send an email to unitrap@crg.es