Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12504H5
Clone ID IST12504H5
Vector VICTR76
Project tigm

Sequence tag IST12504H5HMF1
Sequence
AGAGAAGTCAGGCAAGCAAGGCACTTCCTGCACCAGATATAGATGCAGGGAGAGGTGGACAGACACAGTCCCAGACAGGC
AGGTAGCACTCGCACACACACACACACACACACACACACACACACACACACAN
Sequence Type genomic DNA
Unitrap ID UNI31368

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59097151..59097282 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009900 (Wnt3a) NM_009522 wingless-related MMTV integration site 3A Gene [Source:MGI (curated);Acc:Wnt3a-001]


Sequence tag IST12504H5BBF1
Sequence
AGAGAAGTCAGGCAAGCAAGGCACTTCCTGCACCAGATATAGATGCAGGGAGAGGTGGACAGACACAGTCCCAGACAGGC
AGGTAGCACTCGCACACACACACACACACACACACACACACACACACACACACAN
Sequence Type genomic DNA
Unitrap ID UNI31368

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59097149..59097282 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009900 (Wnt3a) NM_009522 wingless-related MMTV integration site 3A Gene [Source:MGI (curated);Acc:Wnt3a-001]

 
Come back to gene ENSMUSG00000009900


For any suggestions or comments, please send an email to unitrap@crg.es