Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14984F3
Clone ID IST14984F3
Vector VICTR76
Project tigm

Sequence tag IST14984F3BBF1
Sequence
CTATATACTCACACCCACACTTCCCCATACACACAAAGAACAGAGGGGAAGGGACCAGAGACCGTGTATCTTAGTAAGCT
GTGCATCTCAGGCACAGCACAGCATCTTCAGACTCACCAGAAAAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114415711..114415847 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST14984F3HMF1
Sequence
CTATATACTCACACCCACACTTCCCCATACACACAAAGAACAGAGGGGAAGGGACCAGAGACCGTGTATCTTAGTAAGCT
GTGCATCTCAGGCACAGCACAGCATCTTCAGACTCACCAGAAAAGGGCATCAGATCTCATTACAGATGATTGGGAGCCAC
CATGTGGTTGCTGGAATTTGAACTCAAGTCCTTCAGAAGGGCAGTGAGTGCTCTTAACCGCTGAGCCATCTCTCCAGCCA
TCCTGTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTGGTTTTTTTGAGATAGGGTTTCTCTGTATAGC
CCTGGCTGTCCTGGAACTCACTTTGTAA
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114415501..114415847 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]


Sequence tag IST14984F3HMR1
Sequence
AGGTNAAAGGACAAAGACAATTTGGGGGAATGGGTTCTGTCCTTCCATCATGTGTATTCCTACAATGTACTTACATAGAA
TAATAAATAAATCTTTGGGCTGGAGCGAGCAAGACCAGAGCAAGCAGAGGTCAAATTCCTGGAATACACTTAAAGGCTGT
CTTTCCTGCTGATTCCGGGGCGTCTTCCTGGATCACACACCCANCTCTAGAAAACCCGGAAGACAGGGAACCGCCCCCTG
TCTGCTCTGCACGAGGCGCCANATGTGCCANCAAGCACTTGTTGCTTTATGCACAGCCATTGATTTAACATAACTGCCCC
TGCNNCANACCTTANGACCTCTGANGTTTANTTGGAGGATTCNAGGCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114415849..114416217 347
 
EST/CDNA Est Name
  AI115260.1 - CJ041956.1 - BB849113.1 - CJ054979.1 - CJ046504.1 - CJ053190.1 - BY230977.1 - AI156825.1 - CJ146966.1

 
Come back to gene AI115260.1 - CJ041956.1 - BB849113.1 - CJ054979.1 - CJ046504.1 - CJ053190.1 - BY230977.1 - AI156825.1 - CJ146966.1


For any suggestions or comments, please send an email to unitrap@crg.es