Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST448712
Clone ID OST448712
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST448712
Sequence
GAGGGTCAGAGCAATGCCTCCACGACCATCTTCGGGTGAACTGTGGGGCATCCACTTGATGCCCCCACGAATCCTAGTGG
AATGTTTACTCCCCAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCCACACTCGGTCACCATCAAACATGAACT
GTTCAGAGAGGCCAGGAAATACCCTCTCCATCAGCTTCTGCAAGACGAAACTTCTTACATTTTCGTAAGTGTCACCCAAG
AAGCAGAAAGGGAAGAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAAGTTATT
GAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGTTATTGGCATGCCAGTGTGTGAATTTGA
TATGGTTAAAGATCCAGAAGGGAGAAG
Sequence Type mRNA
Unitrap ID UNI17136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32335115..32336093 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027665 (Pik3ca) NM_008839 phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI (curated);Acc:Pik3ca-001]

 
Come back to gene ENSMUSG00000027665


For any suggestions or comments, please send an email to unitrap@crg.es