Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AJ0502
Clone ID AJ0502
Vector pGT0lxr
Project sanger

Sequence tag AJ0502
Sequence
TGGTTGTGAGCTCTTCTAGATGGTTTAGAAGAAGCAGAAGAAACAGTTACCCGGGATATCCCACCCCTTACAGCACCAGT
AACTCCAGAGAGTGGGTACTCGTCAGCCCATGCAGAGGCCACCTATGAAGAAGACTGGGAAGTATTTGACCCCTATTATT
TCATCAAACATGTTCCGCCTCTGACAGAAGAACAGCTAAATAGGAAACCTGCTCTTCCTTTGAAAACAAGAAGCACACCA
GAGTTCTCCCTGGTCTCAGATCTGGATGAGACAATAGTGCACAGCAGTCGGAATTAGGTAGAAGAGGCAGCGCTCACTTG
TGCAGTCCTTCTCCAAGATGGCATTTATCAG
Sequence Type mRNA
Unitrap ID UNI3259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121807047..121819168 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es