Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10908D5
Clone ID IST10908D5
Vector VICTR76
Project tigm

Sequence tag IST10908D5HMR1
Sequence
NNCTGTCTCAGGAGGTCTGGAAGAATGGCTTCTCCACAGTTTACTTCTGGGTGGGGGATCCAGCAGTGGCTGCTAGAGAC
AGGAAGAACAAGGGGTTTCTGGAAAGTGTGTGTGACATGAGTGTGTGTGGAGGCCAGAGGTTGGGTTGATGTGAAGTGTC
TTCTTTAGGCTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22138312..22138483 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es