Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13303H6
Clone ID IST13303H6
Vector VICTR74
Project tigm

Sequence tag IST13303H6HMF1
Sequence
GATTCAGAGAGACACAGAATGTTCAGCACAGATCTCTTTTTAAAGATTTTTTTTAAAGCCATGAACTCCTGATCCTTCTC
CACTGCCCACGTTTGANAATCCCANATATCAAATCCTGAACTAGCGCAATAGAATCTGCTATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105314943..105315087 141
NO GENE  


Sequence tag IST13303H6HMR1
Sequence
AATCTATGGGAGATAGTTGATATGGTCTCTCAGAGAGACTATATAATAGACTACCTAAACAATACAATATGTGTTGCTCA
TATGCAGAAGGGACTCAGGCAGCTTTGCAGAGTCACTGCAGAT
Sequence Type genomic DNA
Unitrap ID UNI30940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105314824..105314946 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035547 (Capn5) NM_007602 calpain 5 Gene [Source:MGI (curated);Acc:Capn5-001]

 
Come back to gene ENSMUSG00000035547


For any suggestions or comments, please send an email to unitrap@crg.es