Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14656C5
Clone ID IST14656C5
Vector VICTR74
Project tigm

Sequence tag IST14656C5BBF1
Sequence
GCAGAAGGATTACGTGGAACTGGAATACTGTGGGCAGTCCGAGCACACAGCTATGCTCAAGAGAGCTTGGCTCTGCTTGC
TTTTATCTGTTACTTGCTAGCCTACATGTAAACCAGGAGCTGCAGGGCACAATGTCACACACCCTTAACCCCACGAATGA
ACCCAACCTCAAGTTCTCCAGAAGGATAGGGACTAAGGAAACTGAGTCAAATTCTCCCTGAAACATTCTAGCTTTAAAGA
AATAACTGAAAATGAGTTTTAGGCCCCACTGTAGTGTTTCATGGAAGCTGGTTCACATTATCAGCATAACATCAACTTTG
TCCAATTGTCCAATTGCCATAGATTCCTATAACCATTCAAAATAAACATCAAGAGCTTTATGAACAAGGCGGTGCTTGCC
GCTGANGCAGGCAGATCAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53631559..53631977 417
NO GENE  


Sequence tag IST14656C5HMR1
Sequence
TGCTAACTTTCTCCCGTGTGACGTGGGATGGCCTGGACTCATATTGAACCACTTGTCTTACTTAACTTCGTGAATCCTTA
AAGAATTCCCTCGTTTGCTTTAGTTTTAGTTTTTAGAGGCAGGGTCTCTTGTACCCATTTTAACCCCTCACCCTCCTGTT
TCCACCTCCATGTCCTGGAGATTAAACGTAGGGACTCTTGCATACTAGGCAAGCAGTCTACTCCTGATCTATATTCGGCT
TCTGCTAAATTGCTGCGTTC
Sequence Type genomic DNA
Unitrap ID UNI29961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53631975..53632233 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es