Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12001A10
Clone ID IST12001A10
Vector VICTR76
Project tigm

Sequence tag IST12001A10BBF1
Sequence
ATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACANAGTGAGTTCCAGGACAG
CCAGGGCTACNCAGAGAAACCCTGTCTCGAAAAACCN
Sequence Type genomic DNA
Unitrap ID UNI2177 UNI7564 UNI23842 UNI36130

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107477813..107477928 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056536 (Pign) NM_013784 phosphatidylinositol glycan anchor biosynthesis, class N Gene [Source:MGI Symbol;Acc:MGI:1351629]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 24939896..24940011 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98347133..98347248 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31982180..31982295 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022772 (Senp5) NM_177103 SUMO/sentrin specific peptidase 5 Gene [Source:MGI (curated);Acc:Senp5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119016050..119016165 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034278 (Dnajc17) NM_139139 DnaJ (Hsp40) homolog, subfamily C, member 17 Gene [Source:MGI (curated);Acc:Dnajc17-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66110416..66110531 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 141575073..141575188 112
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58086356..58086471 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es