Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11777C3
Clone ID IST11777C3
Vector VICTR76
Project tigm

Sequence tag IST11777C3BBF1
Sequence
AGGCTAACTTTAGCTAGCCTATGGTGAGACCCCGTATTCAAATAAGCAAACAAAAATTGGATGATTTTTGAAATTGCATT
TAATGTAGAGTTGAGAATAACGTCATATTACGTGAGGGTTTAAGGTATGTGCACACTGATACTGTTCCCATTAANATCTG
T
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724231..7724390 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es