Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11364G1
Clone ID IST11364G1
Vector VICTR76
Project tigm

Sequence tag IST11364G1BBF1
Sequence
ATATGAATGAGGGATCATTGNTGTCTTCCTGCTTCCGTTCCCTGCCCCCTCTTCANTTTGTAAAGACATGAGGACACAGC
CTGGGGTGCCTCCTTCCTCCTCAGTCCTGCCCCTGGCTCTGCCGCTCTGCANGGCTGCTGGCTCTGCTGCCTGCCTGCCT
GCCTGCCCANCTTCATTCTCGTTCATCTATANGGAGCATCTGGTGCCANATCCTACAGGGCCNGCTGGANGANGCTGCTC
ACCNNCTGGAGTTCCTCAAGGAGGTGCANCANTCCNTTGNNAAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11364G1HMF1
Sequence
ATATGAATGAGGGATCATTGTTGTCTTCCTGCTTCCGTTCCCTGCCCCCTCTTCANTTTGTAAAGACATGAGGACACAGC
CTGGGGTGCCTCCTTCCTCCTCAGTCCTGCCCCTGGCTCTGCCGCTCTGCAGGGCTGCTGGCTCTGCTGCCTGCCTGCCT
GCCTGCCCANCTTCATTCTCGTTCATCTATANGGAGCATCTGGTGCCANATCCTACAGGGCCAGCTGGAGGAGGCTGCTC
ACCANCTGGAGTTCCTCAAGGANGTGCANCANTCCCTTGNNAAGTCN
Sequence Type genomic DNA
Unitrap ID UNI36131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119859527..119859812 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032514 (Ttc21a) NM_028735 tetratricopeptide repeat domain 21A Gene [Source:MGI Symbol;Acc:MGI:1921302]

 
Come back to gene ENSMUSG00000032514


For any suggestions or comments, please send an email to unitrap@crg.es