Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11095G7
Clone ID IST11095G7
Vector VICTR76
Project tigm

Sequence tag IST11095G7BBF1
Sequence
TCCTTATGCTTTTAAACGGCAGACTCTGAATTGGTCAGTCTAAATTCTTTTGGTGTAATTAAATCTTAATTAAAATGCAT
AATAAGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAAC
CACATGGTGGCTCACAACCATCCATAACAAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11095G7HMF2
Sequence
TCCTTATGCTTTTAAACGGCAGACTCTGAATTGGTCAGTCTAAATTCTTTTGGTGTAATTAAATCTTAATTAAAATGCAT
AATAAGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAAC
CACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTAC
ATATAATAATAAATAAATCTTAAAAAAAT

Sequence Type genomic DNA
Unitrap ID UNI31091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 93711..182455 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079834 (Tmlhe) NP_620097 trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]

 
Come back to gene ENSMUSG00000079834


For any suggestions or comments, please send an email to unitrap@crg.es