Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13842H4
Clone ID IST13842H4
Vector VICTR74
Project tigm

Sequence tag IST13842H4HMF1
Sequence
TTCATCGCTGTCTTTGGGCTGAAAAAGAAACCCTTCTGATCACAATCCGGGTGTAGGGACCAAGGCTGGAAAAGTGATGA
AGCTTCCTCCCACTGCTGCAAGAAAAAGGCAGAGGCTTCAGTTTTCTCTCGCCCAAGTCCCTTGCTCCTCCCAACTGCGG
CTAAGCANAGGATGGCAGTGTTGGAATAAAATCTCTCAAATCTTGGATTATAATTTTATTANAGTTTTGTAATAAAATTT
ATTTTATAACAAGAGCAAGGCGTATACTATTTTTCANAAGACCATTGGATGGGCCAAGAGGCTGGTATAAATAAAGGCTT
TTATCTTGTGGTTAGGGCTANAAGTNATGCTTCNATTTGGGTTTTNACNCTNNAAGCNNGGCGGAAATGAGTGGGCGGGG
G
Sequence Type genomic DNA
Unitrap ID UNI32888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68886279..68886678 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020895 (Tmem107) NM_025838 transmembrane protein 107 Gene [Source:MGI (curated);Acc:Tmem107-002]


Sequence tag IST13842H4BBF1
Sequence
TTCATCGCTGTCTTTGGGCTGAAAAANAAACCCTTCTGATCACAATCCGGGTGTAGGGACCAAGGCTGGAAAAGTGATGA
ANCTTCCTCCCACTGCTGCAAGAAAAAGGCANAGGCTTCANTTTTCTCTCGCCCAAGTCCCTTGCTCCTCCCAACTGCGG
CTAAGCANAGGATGGCANTGTTGGAATAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI23732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68886279..68886472 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020895 (Tmem107) NM_025838 transmembrane protein 107 Gene [Source:MGI (curated);Acc:Tmem107-002]

 
Come back to gene ENSMUSG00000020895


For any suggestions or comments, please send an email to unitrap@crg.es