Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606B6
Clone ID IST13606B6
Vector VICTR74
Project tigm

Sequence tag IST13606B6HMF1
Sequence
ACAACACGTATGGCTTTAAAAGGCATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13606B6BBF1
Sequence
ACACAACACGTATGGCTTTAAAAGGCATGTTGACTGGTTANCCTAACGGGTGCAGCCACACCTCCTCCTGTTTGTTTAAC
GTGTTCTANACATATCCTTGTAAAGAAACACAGGATTTCCACCTACTAAGGGACTTCTACTATAATATGTACAAAAACTG
TGGTCTTTTTCTGAGTCCAATTTGAAATGTTTCATTAAATAAATAATAAATTTACTAAATTACNAATTANTAAAACTATA
CTTTGTNNNANGGTTANNGTAGTNAANNNNNTTATTTGATTAATGANCNNAANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13606B6HMR1
Sequence
GTGTGTGAGCATTTTTTTAAATATATAGAAAATCCCCAAAATAGCTAGTATAATAAGCACACATGCCAGTAAGCCTCTTA
TTACTGTAAAATACTGTGTAATACTTTGTGCGTTCTTTTATGTGACTGCAGTAGGTCTGTTTACATCAGCATTTACCCAT
ACAAGGTGGCTACTGTCATTCAGGCCTTGGAAAGTTTTCAGCTTCTTTGAAACTTGTGGGGTTACTTCTCCAGTTGTATG
TGCTGTCCATGGTTGGCTAGACATGGCACATGACTGGCGCATGGACCTAAAGACAGATTAAAGAATTCATTTCAAATGAT
TTCAAGCACAGAGTTTAAATTGTACATGCACTCTTANTCAATGTCCTTGTANCTGCATTTTGGTGTANTTGGAGGN
Sequence Type genomic DNA
Unitrap ID UNI31647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18857222..18857616 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031467 (Agpat5) NP_081068 1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) Gene [Source:MGI (curated);Acc:Agpat5-001]

 
Come back to gene ENSMUSG00000031467


For any suggestions or comments, please send an email to unitrap@crg.es