Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10322A3
Clone ID IST10322A3
Vector VICTR76
Project tigm

Sequence tag IST10322A3HMR1
Sequence
ACNNNTCCTGGGCTACTTTCTAGACTCTGCATTCCTGAGTCTTCTACCATCAGAAGGATGTTTCTATGGAACCANAAACA
TCCTCAGGGGTTTCTCCTAGATGTAACATTTCATTGGGATCCTCCTGCTTTTCCTTCC
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44778705..44778837 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]


Sequence tag IST10322A3BBF1
Sequence
CAACAGAACTCCAATAAAACTCGCGGCCAACTGGGGCAGTGACTGGATTATACATCCATGCAAACTCAGCAAGAAGCTGG
AGAAAGATCTGTCGAGGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71180502..71180592 91
NO GENE  

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es