Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14677H7
Clone ID IST14677H7
Vector VICTR74
Project tigm

Sequence tag IST14677H7BBF2
Sequence
TTTTATGAGTCATATGCACATTAATACAAAAGTAGGAAGAATAATCAAAATCAAAACTGGAAACTAATATTTCTATATTT
CTATAGCTAACATCATATGCTAGAGACTCCCCTAAGTTTCAGGAACTTTGCAAGGATGTCCACTCTCAGAATTCTTATTT
AACACAGTAAGGGAAGTCCCAATTAGAGGAAGCAAGAAAGGAGACATTGGGAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40046024..40046243 220
NO GENE  


Sequence tag IST14677H7HMR1
Sequence
NACTGACATTCCAGAGCTCTCTTGANAAACAGGAGACTTAAAAAGCTTTTATAGAGTCTATAAATAAAGAGGATTTTTAT
GGGGTAAGGAGTGCTATGGTTTGANATCAGTGGGATTTTCATGGANTGGGGTGNNNAAN
Sequence Type genomic DNA
Unitrap ID UNI12693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127983315..127983446 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039810 (Zc3h10) NM_134003 zinc finger CCCH type containing 10 Gene [Source:MGI (curated);Acc:Zc3h10-001]

 
Come back to gene ENSMUSG00000039810


For any suggestions or comments, please send an email to unitrap@crg.es