Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886A3
Clone ID IST14886A3
Vector VICTR76
Project tigm

Sequence tag IST14886A3BBF1
Sequence
CTACATCTAAGAATAAATATGTTTAGGTAAATAAATGCTAACACTTTTGTATCCATAGCAAAGTTTGAAACCTATGAGTG
TGAGGATAGGGCTCTGGGCAGAATGCCATTAAAACAAGTGTGGTAAAATGTGTTTAAAGTGACTACCTGAGCCATGCGAT
GCTTAGATCCACCACAAACCCCATGCTGCATCATCACCAGCTACACAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29488109..29488321 213
NO GENE  


Sequence tag IST14886A3HMR1
Sequence
GTAGCTTTACACAATAAATTATGTCAAAACAGTTTTAAAACAGAAGTGTGTAGTGGCTTCATTAGTGACCATGTGTACTG
CTTGATGGGCTGAGAGGGACTNGGTAAAGGGCCGTCTGGGTACAGTGGCTCCTCTGTTGGGTCTAGCCCTTGANGANCCT
GTGTGTNNNNGAACCCTTGNNNCN
Sequence Type genomic DNA
Unitrap ID UNI15349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29488318..29488496 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]


Sequence tag IST14886A3HMF2
Sequence
ATAGAGATAGATGTTCATAGTATTTTAAATGTTCTTTCAGTAAGTATGCCAAGAAGTTTTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4842939..4843004 66
NO GENE  

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es