Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12579A1
Clone ID IST12579A1
Vector VICTR76
Project tigm

Sequence tag IST12579A1HMF1
Sequence
TCTGCAAGAACAGGAAGCACCCAACTGTGAGGCNNTCTCCCCAAACCCCACAACCCCCCTTTCCTATCACGTATTCTTTA
AAGTGTTCTCTANATACACATCTGCATGTGGTAGAGATGTGCTTTCAACGTCTCCCTGTGTTATTGCTCTGTTGTGTTGA
TTCATTTTCTTTATTATTAAAGGATCTAGAGATTGAAAATGAAGATTTAAGAGAGAAGTTGAGGAAGATTCANCAAGAAC
AAAGAATCCNCCTGGATAAAGTCAATGGCTTACAGTTACAGCTGAATGAGGTAAATAGTCTGAATTAAGAAGAAAATCCA
AAAGCTGTGTTACCATGGTAACAGTCNTCTGCAGTCAGTCNTCGCCTGCAGCTCTTCTCTTTGCATCAAGATACTAAAGG
ANGCGGGCGCACTTGGGTCATGGCCCGTAATGNGTTCTGTAATCCTATAGGNACCNCANACTTTGATGGNTGTCTGTGCN
TGTACATATATGCNCATATATTATGTATATACNCNTTNNCNTTGGNCAGTTA
Sequence Type genomic DNA
Unitrap ID UNI36135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 60708677..60709207 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034485 (Uaca) NM_028283 uveal autoantigen with coiled-coil domains and ankyrin repeats Gene [Source:MGI Symbol;Acc:MGI:1919815]

 
Come back to gene ENSMUSG00000034485


For any suggestions or comments, please send an email to unitrap@crg.es