Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST448457
Clone ID OST448457
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST448457
Sequence
AACTGAGATGCAAGGAGACGTAAGCCCCAATCCTTCCCTTATTGACAGAACCATCAAGATGAGAAAAGAAACAGAAACTA
GGAAAGTGGTTTTAGCTTGGGGACTCCTAAATGTATCCATGGCTGGAATGATATATACTGAAANGACTGGAAAGTTAATC
AGTACATATTATAATGTGACATACTAGGCCCCTCTGGTATATNGAACTCCCACTTGCATCGCTCTTCANTCTTAATGCCT
TGNTTGATTTTTGGAGATACTTCAAATATACCGTAGCACCAACAAGTCTGGTAGTTAGCCCCGGACAGCAAGCACTGTTA
GGGTTGAAACAGGCTGTTGTGCAGACTACACCTCCCCGTGATTTGGCAGCAACCCAAATCTCTCCATCTCCACCTTCCCC
TTCGATTCAAGGTCAAAGTGTGTTAAGTTATAGCCCATCTCGTTCACCCAGTACCAGTCCCAAGTTTGCCACCAGCTGTA
TGGGCCAA
Sequence Type mRNA
Unitrap ID UNI17151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30455829..30458804 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029782 (Tmem209) NM_178625 transmembrane protein 209 Gene [Source:MGI (curated);Acc:Tmem209-004]

 
Come back to gene ENSMUSG00000029782


For any suggestions or comments, please send an email to unitrap@crg.es