Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10989G11
Clone ID IST10989G11
Vector VICTR76
Project tigm

Sequence tag IST10989G11BBF1
Sequence
CCTCCCAAATGCTTGATCAAAAGTGTGCATCATTATGGCTAGCTGGATTTTGTGAGACCTCCCAGCNGGGGGATTCGGGA
GACTTGAGGGTGGTGTTTCTCCTTGCTGCAGACTTTGGGAGAGAACAGTCATTAGAGGGAAGGAGGGAGACAAGANGAAA
CCGGGTGGTAAAGTGGCTATGGAGCACAGGTCCTCCGACACGCNNNTGCNTGCCGGCNTCATGAAGGGTAGGGAAAGAGT
GTTGTCGGTGCTCANACAGACATGAGAATCCTCCCTAAAACACAGCATATAATTTCTTAGTCTCAGAAATAATTTTCCCT
AGTTAAATACAAACAANACAAAACAAANAGACTATCTCTGATGCTTANATATATGTGTGCATGCGCAATTAGGTTAACCN
TATNAGCNNTTGGGAGATGGCTCAGTGGTAAAGTGCTCACTGNACAAGCAAGAGAGCCNCNGTTCACGTCCTANGGATCT

Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29334362..29334840 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]


Sequence tag IST10989G11HMF1
Sequence
CCTCCCAAATGCTTGATCAAAAGTGTGCATCATTATGGCTAGCTGGATTTTGTGAGACCTCCCAGCAGGGGGATTCGGGA
GACTTGAGGGTGGTGTTTCTCCTTGCTGCAGACTTTGGGAGAGAACAGTCATTAGAGGGAAGGAGGGAGACAAGAGGAAA
CCGGGTGGTAAAGTGGCTATGGAGCACAGGTCCTCCGACACGCANCTGCNTGCCGGCATCATGAAGGGTAGGGAAAGAGT
GTTGTCGGTGCTCANACAGACATGAGAATCCTCCCTAAAACACAGCATATAATTTCTTAGTCTCAGAAATAATTTTCCCT
AGTTAAATACAAACAAAACAAAACAAAAAGACTATCTCTGATGCTTAAATATATGTGTGCATGCGCAATTANGTTAACG

Sequence Type genomic DNA
Unitrap ID UNI33308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29334443..29334840 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es