Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12816F2
Clone ID IST12816F2
Vector VICTR76
Project tigm

Sequence tag IST12816F2HMF1
Sequence
ACATGAACTTGAATCCTTGACTGGGAGCCTGGGCAGCCTCTTAAACCTCTTTCCAGTTACTCACAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51964214..51964284 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]


Sequence tag IST12816F2HMR1
Sequence
ATGTCACATTTTGTAATTTGCAGTTGCATTCTGGGTCTTAAAATGGAAACAAGCANCCNGGCCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51964152..51964217 62
NO GENE  

 
Come back to gene ENSMUSG00000019891


For any suggestions or comments, please send an email to unitrap@crg.es