Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10653C12
Clone ID IST10653C12
Vector VICTR76
Project tigm

Sequence tag IST10653C12HMF1
Sequence
ACCCTAGTTGGCCTGGCTATATGGTCCAGGCTGGTCTTGAATTCACAATGATCTACCTGCCTCTGCCTCCCAAGTGCAGG
AATTAAAGGAATGTTCCAGCATACCTGGCCTCTACTTTTAATCTTTTAAAAATTAGGTTTTGGGGCCGGAGAGATGGCTC
AGTGGTTAAGAGCACTGACTGCTCTTAAGGTCCTGAGTTCAATTCCCAGAAACCACATGGTGGCTCACAACCATCCATAA
CGAGATCTGGCGCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGCATACTTACATACNATAAATAAATAANTCTTTAAAA
GAAAATTANGTTTCATTACAAACCTTACAACCNNAAGCTGTAAAAAGTCACAATGAGAAAACCAGGGACTTGTGTGGTAN
TANCTGGCTCAGTGTGTACTGTACTTACCCANNAAGCATTANNACCTGAGCTCATATACNCAGCAGCCATGTAAAAGGTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721889..69722367 455
 
EST/CDNA Est Name
  BY712115.1 - BY741237.1 - CB057959.1 - BQ964574.1 - CB057374.1 - CJ063020.1 - BB617772.1 - CV676844.1 - BE134734.1 - AI787170.1 - BI441040.1 - AW990356.1 - AA033084.1 - AA466649.1 - BG142553.1 - BY296890.1 - BY288211.1 - BF117664.1 - BY295899.1 - BB841057


Sequence tag IST10653C12BBF1
Sequence
ACCCTAGTTGGCCTGGCTATATGGTCCAGGCTGGTCTTGAATTCACAATGATCTACCTGCCTCTGCCTCCCAAGTGCAGG
AATTAAAGGAATGTTCCAGCATACCTGGCCTCTACTTTTAATCTTTTAAAAATTAGGTTTTGGGGCCGGAGAGATGGCTC
AGTGGTTAANAGCACTGACTGCTCTTAAGGTCCTGAGTTCAATTCCCANAAACCACATGGTGGCTCACAACCATCCATAA
CGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721889..69722137 245
 
EST/CDNA Est Name
  BF117664.1 - BB841057.1


Sequence tag IST10653C12HMR1
Sequence
GTTATATAACNNGACACTGTCTCAAAATAAACAAGCAAACAAATACATACATACATAATCNGTTCTTTCATACCTAGTTT
CTAATGTGCACGACATGAGTTTCAAAGTACCTGCAACAGTAATTAACTATCCCAGAGTTGGTTTAAAAATGAGATTTATT
AACCGGGTGTGGTGGCGCACACCTTTA
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721704..69721890 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es