Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11562E1
Clone ID IST11562E1
Vector VICTR76
Project tigm

Sequence tag IST11562E1HMF1
Sequence
TTATAACACCCGTTGCAGGCTCTCANGATTTANACAGAGGCCAGAGGGACCTTCTGCCAACACCAGATAGTAGCTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101495288..101495364 73
NO GENE  


Sequence tag IST11562E1HMR1
Sequence
GACTCTCTATNNAACTTCTCCTTAGAACAAAANNAAAACCTGGTAATGCANCAGCCACTTAAAAGCCACAGAGCGGCTGC
CAGTTCCTAAATCTGCGGGAAGGCTTAGCATTTGGACCTCTGTGGAATCCCACGGAGCCAATAGGCCAAGGGGACATTCC
CATTGGACAAACGCTTCTCTTCTTTTCTATCATGGGCAACTTACTATCACATAAAACATCACCCCAGGCCANANAAATAC
NTGCCTTACTAAAACACCAAGGAATAAAGATATCCNAAGAACTANCCTCCTTGTTTTGGGAGGAAGTCCTTCANATANCA
CCATGCATGGCC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101494952..101495283 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es