Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15011H2
Clone ID IST15011H2
Vector VICTR78
Project tigm

Sequence tag IST15011H2HMR1
Sequence
CTGTTACATGTTTNNCAGCCTCTACGCTAGTGCCCTANCCCTTCTCACCTCCCAGATACCCTTTGTTCTCTGTAGGACAT
GTATCCTCCTCACCCCANCAACTCATGTTATCTCCACTATCCTCCCAGCACACCCCACCCCTGCTCTACTGGCTTGCTCT
CCTGCAGACAGCTCTGGACACATCCANTCCACTTTTTTTTTCTTCCTCCTCTGTTCTGGACTCTTCCAAATGTTTCAGGA
TATTTTCTCTCTCCTATTCAAAAAAACAAAAACAAAAAAACCAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97070667..97070971 295
 
EST/CDNA Est Name
  BY483091.1 - BY484426.1 - AA119818.1 - BB679654.1 - BY407916.1 - BY483052.1 - BY548830.1 - W10179.1 - AA760483.1 - AI324454.1 - AA882001.1 - AA288817.1 - W41662.1


Sequence tag IST15011H2BBF1
Sequence
CTCTTAAGATTGCTCAGACTCTTTGTTTATTCTTTTTTCATTTTAAGGTAATGAGTGTATAGTGAACATAAATGTTTACT
TAGTAGTTGTTCCACACCAGGGCTACAGATTGAACCCAGGACCTCCTACAGGCTAGCTAGGCACTTGCCCTATCATTGAA
CTACACACTCAGTCCAAATGAACGTGTGAACACTAATCATTAACAGGAGCTAGGCACGGTGGTACACGCCTGTAACCCGG
AATTTANAAGACAGGGATANNAAGATCAAGACTTTAGAGCCACCATGANTTTGAGGCNNNCCTGGTTCTCNGCAACNNCC
AAGGCTACNCNNANAAACCCTGTCTTTGGAAGAAAANAANAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15011H2HMF1
Sequence
CTCTTAAGATTGCTCAGACTCTTTGTTTATTCTTTTTTCATTTTAAGGTAATGAGTGTATAGTGAACATAAATGTTTACT
TAGTAGTTGTTCCACACCAGGGCTACAGATTGAACCCAGGACCTCCTACAGGCTAGCTAGGCACTTGCCCTATCATTGAA
CTACACACTCAGTCCAAATGAACGTGTGAACACTAATCATTAACAGGAGCTAGGCACGGTGGTACACGCCTGTAACCCGG
AATTTAGAANACAGGGNTNNNAANATCANNACTTTNNAGCN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856141..84856420 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es