Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13980D4
Clone ID IST13980D4
Vector VICTR74
Project tigm

Sequence tag IST13980D4BBF1
Sequence
AGGGGGAAGCCNCAAGGNGGGCGGATCTGGGCGCCCAGTGTCCCAGGGCCTTGTGGGCTGTGAAAGCACAGGCTGTGAGC
TGACCAGCAGTCCCCTGGTATAGGAACCAGCGCTGCAGACTGACACAGGAGGGCAAGTGCTGCGCCCANGGCCTGCGCCT
CCGCCACCACTACATGCTGTGTGGGGCGCTGCTGCGTGTGTGGGGCCNCATCGCCGCTGTCNTGGCGGATGTCANCNNTN
NCNNCTNNNTACAN
Sequence Type genomic DNA
Unitrap ID UNI31594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79520761..79520994 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]


Sequence tag IST13980D4HMF1
Sequence
AGGGGGAAGCCNCAAGGAGGGCGGATCTGGGCGCCCAGTGTCCCAGGGCCTTGTGGGCTGTGAAAGCACAGGCTGTGAGC
TGACCNNCAGTCCCCTGGTATAGGAACCAGCGCTGCAGACTGACACAGGAGGGCAAGTGCTGCGCCCAGGGCCTGCGCCT
CCGCCACCACTACATGCTGTGTGGGGCGCTGCTGCGTGTGTGGGGCCGCATCGCCNCTGTNNTGGCGGATGTNNNCANTA
GCAGCTACCTACAGATTGTGCGCCTTAN
Sequence Type genomic DNA
Unitrap ID UNI31594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79520728..79520994 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

 
Come back to gene ENSMUSG00000035673


For any suggestions or comments, please send an email to unitrap@crg.es