Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980A11
Clone ID IST14980A11
Vector VICTR76
Project tigm

Sequence tag IST14980A11BBF1
Sequence
GTACGTGAGTGCACTACTCTGAAGTGTTATGACATGGACTGCCTGCCATTTAGGGGCAAGAATGTCTANAGGGACATTCC
ACCACTACCGTCTGGTTGAGAACTGAGAGACCATGTTTTANTAGACAGCTTTATCTGCAGTGAACTTCCTGTTACTTCAA
GCGCCTGTGAGACAGCTACTAAAACAAATCCCCCAGACAACGTTCTATAAAAGCATGCCATAATGGTTTTGAAATGAAAA
GAACCTTTAAAAAAGTTACGATAGGTTCACCTATGAAAGAAGCCATGCACTCTGTATGATTTCATTTACATAAAGCGCAC
AATCAAACAAGTCCTACAAGTCAGGACAGAGGTATGTCGGTGTGGGTGGAGGGAAGGATGGCNAGAGATCATGGGCCTGG
CCNCAAGCTGCTCTCCCCCGCTGGACACTGCCTGTGCACGGGGGGCTCTGCTGGGGCTGCTTCTTTGACCATGTGTACTT
CTCTACNTNCNTATATGTTACTCATGCNTAAAAAANTNNAANNGGAAAAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72329993..72330524 506
 
EST/CDNA Est Name
  BG069121.2 - AU024673.1 - CD545491.1 - AU040141.1 - CD547375.1 - BM201810.2 - BM201498.2 - AA499983.1 - CO040779.1 - BE992752.1


Sequence tag IST14980A11HMF1
Sequence
GTACGTGAGTGCACNANNNNGANNTGTNATGACATGGACTGCCTGCCATTTANGGGCAANAATGTCTAGAGGGACATTCC
ACCACTACCGTCNGGTTGAGAACTGAGAGACCATGTTTTANTAAACAGCTTTATCTGCAGTGAACTTCCTGTTACTTCAA
GCGCCTGTGAGACAGCTACTAAAACAAATCCCCCAGACAACGTTCTATAAAAGCATGCCATAATGGTTTTGAAATGAAAA
GAACCTTTAAAAAAGTTACGATAGGTTCACCTATGAAAGAAGCCATGCACTCTGTATGATTTCATTTACATAAAGCGCAC
AATCAAACAAGTCCTACAAGTCAGGACAGAGGTATGTCGGTGTGGGTGGAGGGAAGGATGGCNAGAGATCATGGGCCTGG
A
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72330125..72330524 372
 
EST/CDNA Est Name
  AU024673.1 - CD545491.1 - AU040141.1 - CD547375.1 - BM201810.2 - BM201498.2 - AA499983.1 - BE992752.1


Sequence tag IST14980A11HMR1
Sequence
TAGGACAGGCTCTGCTGGGAAATTGCCTGTACACCTCTGGCAGATGANAACCTGGATTGAAGCTGCCTTCTATGTAGCTT
GAGTCGGGGGGTAAATGGTATGTCCCAGTGTTACTTCACTATATAAGATGTGGTGTGGCTGGTCCCAAGAAACCCACTAA
GGCATCTTACATTACANANATCANCTTTCCTCTCCTGTCTACTGTAGTTAGACTGCTGGTGCACCAGCTCCCGTGCTGCC
TACCCTCTCTCGGGTCATGTTCTGTGCTGCTGCACTGTGGGAGAGTGGGCTTTCTTCTCCANAACAAACTGACCAAACTA
GTGTTCTGGGTTCAGCTCTACAGTGGANATGTGATTGTGTTGTGGTTTTAATTTTTGTATGTGGTGGGGGTGGAAATCAA
AGGGCCTTGTACATTCTGGGAAN
Sequence Type genomic DNA
Unitrap ID UNI2968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107458986..107459407 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]

 
Come back to gene ENSMUSG00000010067


For any suggestions or comments, please send an email to unitrap@crg.es