Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12592E3
Clone ID IST12592E3
Vector VICTR76
Project tigm

Sequence tag IST12592E3HMF1
Sequence
AAAACAAATCCATCAATCACTAGCTGTTTTGAGGATCAAAGAAACCCAGCATATTTCACAGGTTAGCTAGGGAAGGGTTC
CATGTCCTGGGACTCCCAAACTTTGGTANAAAAGACAGTAATAGTACACACTAACAAAAGCATACATGTATACCTATGAC
TGCTCCCCCACCCCCAAACAAAGCAAATGANTTCTTTCTCAAGAAATTGTTGCTAACCCACACTAAATCAGGGCATCCCT
CCATATGCACCANGCCTTTCTAAGTTTTCCTATANTCNNANATGTTANCAAGAGGACCATCANCATATCTGGTGTGTGAC
CCCNTTNCCNNCCCATANACNGNGCNAGCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12592E3BBF1
Sequence
AAAACAAATCCATCAATCACTANCTGTTTTGAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44724307..44724341 33
NO GENE  


Sequence tag IST12592E3HMR1
Sequence
NNNTTTTATCTTAAAAAGAAACAGAGGAATTCCCAGGGTCCCAGAGCNNATAAAGTCATTTAGTGACAAGGCCTGCTATA
CAGAGATTCGGATTTTGACAACCACACAATGTATGCTGTCTTACCTGTGGTATTATCAGAGTTTGGGGTTTTTTTGTCTT
TCTTTTTAAGTTTTAATATATAANAACTTAGGGCTGGGAAAATGACCCAGTGACTAAATGTATGTAGTGTTCTTCTACAG
GACCTGAGAAAGAGTTCTCAGCATCCATGTTTGGCTGTTGATAACCGCTTACATCTCTAA
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44724014..44724309 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es