Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506D8
Clone ID IST14506D8
Vector VICTR74
Project tigm

Sequence tag IST14506D8HMR1
Sequence
GCGGGAGAGATTTGTGCTATTTTGGGTATCTGCTATTCTGCTGCTGTTATCCTGCTGTANACTGCATAAAATTCTANAGC
TGAAATGANATTAANATTTCAATTTATTTACAAATTTACCTTCTCTGTTTTGAACGTTTGCTCCTGATACTGTGTCGGGG
ACTTCACATACACTAATTTGTTTAACCCTGCCAAAATCCTANTGCTGTAAGTACTGGTCCCATTTTACAGATGGCACAAG
GTANNTCNTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI10917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89520033..89520286 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]

 
Come back to gene ENSMUSG00000027951


For any suggestions or comments, please send an email to unitrap@crg.es