Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10782A2
Clone ID IST10782A2
Vector VICTR76
Project tigm

Sequence tag IST10782A2BBF1
Sequence
CCGTGTGCTGGGCTCTTGCCATTTTCNATTCTCCTGACAGGCAGTACGGTCTTCAGTGTTGTTCTCCTCATTTTATACAC
GGANAAATGGATCT

Sequence Type genomic DNA
Unitrap ID UNI29884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135230156..135230248 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es