Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14562H10
Clone ID IST14562H10
Vector VICTR74
Project tigm

Sequence tag IST14562H10BBF1
Sequence
ACACAGTAAACACTNGCCCTGGGGCTAGCGATGGGAGGAGACNNNNCACGGGAAACCGGCCACGGCTTCTCGAGCCGCCA
TCAGACACCTCGCTTCACGCGCCTTCGGGGTGATGGGCTCCAGGCCCAGCCGCGGTCCCCTTCGGGCCCTCGGAGGCCCT
AGGCCCGGCCCACGTGGCGAGAGACCCGGAGCACCCGGCCCCGACAACCACCACACAAAGGAGGCCTGGACGGGCTCTGC
ACGCCTCAGCTACCGCGAGGCCCTCGCGCGCAACGCGGCCGCCAAAAGGTTCCAGAACCAGCCCGCCTAGTGGGGGAGGG
GAAGGGAACGCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998521..4998856 326
 
EST/CDNA Est Name
  AA080237.1 - CN705028.1 - CA579145.1 - CA566588.1 - CN715737.1 - BQ921589.1 - CF156294.1 - BI730980.1 - BY243954.1 - CJ146069.1 - BY247772.1 - BQ917965.1 - BM503064.1 - CK390260.1 - BY261505.1 - BB839853.1 - BY227600.1 - BB864915.1 - CJ173585.1 - BB863038


Sequence tag IST14562H10HMF1
Sequence
TTTACACAGTAAACANNNGNCCTGGGGCTAGCGATGGGAGGAGANNNNNNACGGGAAACCGGCCACGGCTTCTCGAGCCG
CCATCAGACACCTCGCTTCACGCGCCTTCGGGGTGATGGGCTCCAGGCCCAGCCGCGGTCCCCTTCGGGCCCTCGGAGGC
CCTAGGCCCGGCCCACGTGGCGAGAGACCCGGANCACCCGGCCCCGACAACCACCACACAAAGGAGGCCTGGACGGGCTC
TGCACGCCTCAGCTACCGCGAGGCCCTCGCGCGCAACGCGGCCGCCAAAAGGTTCCAGAACCAGCCCGCCTAGTGGGGGA
GGGGAAGGGAACGCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998520..4998851 310
 
EST/CDNA Est Name
  AA080237.1 - CN705028.1 - CA579145.1 - CA566588.1 - CN715737.1 - BQ921589.1 - CF156294.1 - BI730980.1 - BY243954.1 - CJ146069.1 - BY247772.1 - BQ917965.1 - BM503064.1 - CK390260.1 - BY261505.1 - BB839853.1 - BY227600.1 - BB864915.1 - CJ173585.1 - BB863038


Sequence tag IST14562H10HMR1
Sequence
NNGGANTNNGAAAAACAAACAAAAAGCCGTCGCGAATGTGTAAGCTGAGGGGCGCCGGCTTAAGAGGGGAGCCCCATTAT
CCCCCAGGCCTGGCCCGGCCCGACCAAGCTGCCCCCTCGGAGGACCTAGTTGGTTCCCCTAAATCTTCGTGCTCCCCACT
CAAGAGGCTTCGATTTAATCATGANTTC
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998334..4998518 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es