Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058B2
Clone ID IST15058B2
Vector VICTR80
Project tigm

Sequence tag IST15058B2HMF2
Sequence
GTGTATTAGGAATAAACTCTGAAAGCAGTAGGTTGAGATTTTTCATAGATGTCAAC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298866..98298920 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]


Sequence tag IST15058B2HMR1
Sequence
ACACAACCCTGTATCACATTCATATTCATTATTCAATTCTGGACAATGTTTTATTTTTCACTCCTTGTGTTTTCTCAATT
AAGTTATACTTAGTGAGATATCATTTATGTAACCCTAACAATATATTCTGTGTCCCTAAAGTCTATGCTAAAGTCCTCTT
TCTATAGCTTTGTACATTATTTCACATCATTTTCAGTTTCACATACTTACAACTGTAAAAAACACCATTATAGGGAGGTT
TTAAAAAATAAAAGGGGTGTTGGGTCGGTTTAATTTGTAGCATAAATTCAAAACAATCTAAAGAAAACTCCTAACAGGAA
AGCTGATTCCAAAGTATTTTGTTTGTTTGAAGTTGCATTCACTTGGCTGTAAATTCAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121774912..121812411 336
NO GENE  


Sequence tag IST15058B2BBF1
Sequence
GTGTATTAGGAATAAACTCTGAAAGCAGTAGGTTGAGATTTTTCATAGATGTCAACTAAAATTAGTTAAGACCATGTTGT
GTTATAGTTGATATAAAATTTTACATAGTTAATGTATGTATTCTGATACATTTGCACATAATACCTACTCCCAAGCAACC
CCATTCTACTGAGTTCTCATAAAAATGACTGAATTGCCATAGATCCCAGCAGTCTTCTCAGTATAGTTTCCATGCACTTG
AAATTAGTTTAAAGAAGAACCAGAATTCTCATGTTCATTACAGTTGTATTATGGTAGCCTAAT
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298619..98298920 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es