Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12647E3
Clone ID IST12647E3
Vector VICTR76
Project tigm

Sequence tag IST12647E3BBF1
Sequence
TTGGGATTTGAACTCTGGACCTTTGGAAGAGCANTCNGNTGCTCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12647E3HMF1
Sequence
TTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTTATTATG
Sequence Type genomic DNA
Unitrap ID UNI5651 UNI15045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70674926..70675000 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020817 (Rabep1) NM_019400 rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI (curated);Acc:Rabep1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165697942..165698016 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es