Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10381E2
Clone ID IST10381E2
Vector VICTR76
Project tigm

Sequence tag IST10381E2BBF1
Sequence
CTCCCACCCTGANAANAGCCACCGANGATGATAAACACCCAGGACAGTAGTATTTTGCCGTTGAGTAACTGTACCCAGCT
CCAGTGCTGCAAGGCACATGGTTCCAGGGCCTCTGTGGTGCTCCTGATGCCCCTCACCCACTGTCGAAGATCCCCGGTGG
GCGAGGGGGCGGCAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI36151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135189344..135189523 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083610 (AC110164.26)  

 
Come back to gene ENSMUSG00000083610


For any suggestions or comments, please send an email to unitrap@crg.es